thanks i tried that.. all i need to know is how is he sorted the numbers using the shift operators and & instead of using place value notation in this sorting...
i hope you understood what im...
Type: Posts; User: kraghavan
thanks i tried that.. all i need to know is how is he sorted the numbers using the shift operators and & instead of using place value notation in this sorting...
i hope you understood what im...
Hi all, Im trying to learn radix sorting here. I found this nice sample code. While trying to undestand the code i have a few doubts.
Can you explain what the coder has done?
#include...
Hey the problem was solved....
Its simple to degine a dyn array of bool
How i tried was define a global
typedef bool* typedefvariable;
and used it to declare bool ptr variables inside the class....
ok sorry for that....
in class defnition
class object
{
vector<bool> B;
void someoperation();
}
class b
{
bool * bvalue; // error is here!
void bsizesetter(int size);
.....
// a lot of functions and variables;
}
b::b()
{
Thanks.. mean while... in the object constructor i just declared an empty bool array whose size i initialized later....in another function.. it still works.. can u tell teh difference.. if its right...
The vector bool will contain true or false values if the some conditions are met.
So each position in the bool vector will correspond to an object. If this object is tested and it passes.. the...
Hi all
How to create a dynamic array of type bool and set all values to false?....I know this qs is simple
but I tried declaring a boolean array like
bool *sample;
//later....
sample = new...
hey
thanks for the help...
to run it continously.. i have to use a flag like a bool value.. inside the while and operations....
it helped
cheers!
regards
KR
Hi
this algo is correct,
But you see sometimes the entire 2nd row if pushed into 1st row if all elements in 2nd row pass a test. So forloop is not advisable. I use while loop onle here.....
SO i...
Hey i tried the problem using this.. can you tell me if the flow of logic is right in my steps?.. would appreciate any help...
do
{
if (abs( v[i].back() - v[i+1].front() ) < 5)
{...
i got the segment fault only becuz the size of the vecotr became zero and the system dint know what to do...
I want help in given telliing the system to move forward when the size of i+1 becomes...
yeah thanks.. thats what i expect... but how to handle it when the vector becomes empty... i want the next set of vector to be pushed forward... can you suggest what to code when the size of v[i]...
No i tried IF condition... but u see i need the elements to be pushed into prev array as long as they are less than 30 of difference. if does it once... can you suggest how can handle continous...
OK i got your point. But i tried this way. i gives me a segmentation fault...whats the problem here can any1 help me??
I will be greatful.
#include <iostream>
#include <vector>
#include...
Hi all
I have a2d vector say
vector<vector<int> > V ( 5,vector<int>(5)); // 25 size
Suppose i want to do this operation. if the last element in vector[i] and the first element of v[i+1] differ...
hey thanks. I have now done the reading mode of a file to binary... directly instead of characters...
I had a text file called base.txt
it had a few characters as ATGCCGCGCGCATTTTTCCCAAAA of...
instead of reading a file with text characters i was thinking of
1.change the text input files -> binary data stored for input
2. use binary file and store it in a array. convert it as character...
Hi all,
Im trying to reduce the file reading memory consumed for a problem.So i wanted to try doing this thing.
I have a text file of 2 million characters. This file when read each time by my code...
Im not sure what you mean by asking how the objects like Nucleosome ... look like
Organizationof my objects are
1.ListBloc(masterclass) (double linked list) used in main file ->2. Bloc ( list...
hey
The way i set the histone class objects when they are used in Nucleosome is by initializing the histones in Nucleosomes contructors
here is that code
Nucleosome::Nucleosome (const...
Hi
Im coding for a 5 layer-object model. I ve a array deletion problem when i clear all dynamic arrays in the end. Can you please help me about it.
I will post the initialization and deletion...