hi,m trying to make my front page really cool..
Its on DNA.......and basically,i want my letters to have a "double helix" around a letter...
i was told this was possible
kind regards
...
Type: Posts; User: jodders
hi,m trying to make my front page really cool..
Its on DNA.......and basically,i want my letters to have a "double helix" around a letter...
i was told this was possible
kind regards
...
hey guys,thanks for some tips..
the data looks like:
[code]
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAA
AGAGTGTCTGATAGCAGC...
Hi, my program works fine but its not very efficient. It struggles with large files. I was pretty proud of myself that i managed to code it well,but is there anyway of making it better?
this could...
hi gang, having problems with a program i am trying to write..
im going to try my best to explain this. I am terrible at explaining when i am nervous. ops:
In some programs i have written, i...
hi,im looking at implementing a suffix tree and i dont know where to begin, or find examples in c++. Just looking for people who know more about these damn trees..
kind regards
JoHn
hi,
i was wondering, if you were reading information from a text file,could you control the amount read in?
For example, if you had 3MB of data (just sequences of letters) in a text file, could...
delete
string data(readFile());
got it working..thanks pianorain :)
hi ppl,
i am having trouble linking my text file into a program that im writing.
I started with a basic string to test the outcome of the program which works fine. So,im now testing the program...
hi hk_mp5kpdw, ihave managed to output the results largest first which i wanted to do.
To improve this program,I have decided to add some human input to the program. Its a little tricky though to...
hi hk_mp5kpdw, you have been most kind. I apologise for taking your time.I have found your comments and help so helpful. I will have a good look at what you have told me and will get back to you if i...
thanks hk_mp5kpdw for your reply,pm;y two errors now!
int main()
{
int variable;
hi guys,i am very very appreciative with the help you have given me.Iam still learning c++ by myself and have found your tips useful. I have found "hk_mp5kpdw " tips outstanding and also pianorain. ...
so how would you loop to the end of the string, instead of looping 4 characters.
everytime i try and compile, i get set undeclared, and strSet undeclared
hi,thanks for the help and time to write that sample code.but i have already done a program similar to that, basically calculating the number of occurences from the string..
how i would find a...
i have already done a program which does substrings of 1,but this program would be "n" substring.
In this case though ACGTCATGAGCTA , the maximal repeat is A. As there are no other repeats.
thank you for the quick reply,
sorry for the lack of information, a letter is allowed to repeat itself. Im looking for the maximal repeat in a sequence.There are only 4 letters in the sequence....
I need help on how i am going to implement this.
i have a sequence of letters such as ATGCATA
and i want to find the biggest number of repeats which in this case woud be :AT
help would be...