Thread: displaying a array to output

Hello to all,

I am trying to display the contents of an array to screen. My problem is with what is going into my array. I am trying to put a sequence of characters into it. I am able to get characters to go into it but, for some reason there not the correct ones??? Below is my source code and the sequence I am trying to put in. I only want the letters to be added.

#include <stdio.h>
#include <string.h>
#include <ctype.h>

main()
{
char test[] = "ORIGIN" ;
char header[100] ;
char sequence[100000] ;
char buffer[10000] ;
char i, c, n, w ;

/* for(n=0 ; n < 999 ; ++n)
{
sequence[n] = 0 ;
{
*/

while(fgets(header, 100, stdin))
{
if(strstr(header, "LOCUS"))
{
int w = 12 ;
while(isblank(header[w]))
{
++w ;
}
printf(">%s", &header[w] ) ;
break ;
}
}



while(fgets(buffer, 10000, stdin))
{
if(strstr(buffer, test)) // start obtaining bases after ORIGIN
{
n = 0 ;
while((c=getchar()) != '/')
switch(c)
{
case 'a': case 'c': case 't': case 'g': case 'u': case 'm': case 'r': case 'w':
case 's': case 'y': case 'k': case 'v': case 'h': case 'd': case 'b': case 'n':
sequence[n] = c ; // put any base character into sequence array
++n ;
break ;
case ' ':
case '\n':
case '\t':
break ; // ignore white space
default:
break ;
}
}


}

printf("%s\n", sequence) ;

return 0 ;
}


SEQUENCE:

1 cctcagatca ctctttggca acgacccctc gycacmataa agataggggg gcaactaaag
61 gaagctctat tagahacagg agcagatgat accatattma aagaaataaa tttgccagga
121 agatggaarc caaaaatgat agggggaatt ggaggtttta tcaaagtaag acagtatgat
181 cagatactca tagaaatctg tggacataaa gttataggta cagtattagt aggacctaca
241 cctgtcaacg taattggaag aaatctgttr actcagattg gttgcacttt aaatttt
//

Any help would be appreciated,
Thank you

Thanks for the advice. Sorry for the ugly code, I am new to programming.

Your loop helped condense everything but, I am still not getting the correct output. And # doesn't seem to put my code in tags.

Heres the code, input and output. The output should be only the letters from the input. I am getting a totally different array of letters then are in the input.

Also, how can I structure my output so that I only print 60 characters per line at a time.

#include <stdio.h>
#include <string.h>
#include <ctype.h>

main()
{
char test[] = "ORIGIN" ;
char header[100] ;
char sequence[100000] ;
char buffer[10000] ;
char i, c, n, w ;

/* for(n=0 ; n < 999 ; ++n)
{
sequence[n] = 0 ;
{
*/

while(fgets(header, 100, stdin))
{
if(strstr(header, "LOCUS"))
{
int w = 12 ;
while(isblank(header[w]))
{
++w ;
}
printf(">%s", &header[w] ) ;
break ;
}
}



while(fgets(buffer, 10000, stdin))
{
if(strstr(buffer, test)) // start obtaining bases after ORIGIN
{
int n = 0 ;
while((c=getchar()) != '/')
{
if(c >= 'a' && c <= 'z')
{
sequence[i++] = c ;
}
}
}
}
printf("%s\n", sequence) ;

return 0 ;
}

INPUT (its an entire file but i am only concerned the following argument of it

1 cctcagatca ctctttggca acgacccctc gycacmataa agataggggg gcaactaaag
61 gaagctctat tagahacagg agcagatgat accatattma aagaaataaa tttgccagga
121 agatggaarc caaaaatgat agggggaatt ggaggtttta tcaaagtaag acagtatgat
181 cagatactca tagaaatctg tggacataaa gttataggta cagtattagt aggacctaca
241 cctgtcaacg taattggaag aaatctgttr actcagattg gttgcacttt aaatttt
//

WRONG OUTPUT

gaagaaatctgttractcagattggttgcactttaaattttgataggggg gcaactaaaggaagctctattagahacaggagcagatgataccatattma aagaaataaatttgccaggaagatggaa

The output should be:

>AJ002507 297 bp DNA linear VRL 14-NOV-2006
cctcagatca ctctttggca acgacccctc gycacmataa agataggggg gcaactaaag
gaagctctat tagahacagg agcagatgat accatattma aagaaataaa tttgccagga
agatggaarc caaaaatgat agggggaatt ggaggtttta tcaaagtaag acagtatgat
cctgtcaacg taattggaag aaatctgttr actcagattg gttgcacttt aaatttt

If anyone has any advice that would be great.

How do I use tags. I selected my source code and hit #. All it did was erase my code.

Originally Posted by gkoenig

Code:

#include <stdio.h>
#include <string.h>
#include <ctype.h>

main()
    {
        char test[] = "ORIGIN" ;
        char header[100] ;
        char sequence[100000] ;
        char buffer[10000] ;
        char i, c, n, w ;
        
     /*   for(n=0 ; n < 999 ; ++n)
            { 
                sequence[n] = 0 ;
            {
    */
                
        while(fgets(header, 100, stdin))
            {
                if(strstr(header, "LOCUS"))
                    {
                        int w = 12 ;
                            while(isblank(header[w]))
                                {
                                    ++w ;
                                }
                                printf(">&#37;s", &header[w] ) ;
                                break ;
                    }
             }
        
      
                                       
        while(fgets(buffer, 10000, stdin))
                {
                if(strstr(buffer, test)) // start obtaining bases after ORIGIN
                    { 
                       int n = 0 ;
                       while((c=getchar()) != '/')
                            {
                            if(c >= 'a' && c <= 'z')
                                {
                                sequence[i++] = c ;
                                }
                            }                            
                    }           
                }
        printf("%s\n", sequence) ; 
          
        return 0 ;
    }

INPUT (its an entire file but i am only concerned the following argument of it

1 cctcagatca ctctttggca acgacccctc gycacmataa agataggggg gcaactaaag
61 gaagctctat tagahacagg agcagatgat accatattma aagaaataaa tttgccagga
121 agatggaarc caaaaatgat agggggaatt ggaggtttta tcaaagtaag acagtatgat
181 cagatactca tagaaatctg tggacataaa gttataggta cagtattagt aggacctaca
241 cctgtcaacg taattggaag aaatctgttr actcagattg gttgcacttt aaatttt
//

WRONG OUTPUT

gaagaaatctgttractcagattggttgcactttaaattttgataggggg gcaactaaaggaagctctattagahacaggagcagatgataccatattma aagaaataaatttgccaggaagatggaa

The output should be:

>AJ002507 297 bp DNA linear VRL 14-NOV-2006
cctcagatca ctctttggca acgacccctc gycacmataa agataggggg gcaactaaag
gaagctctat tagahacagg agcagatgat accatattma aagaaataaa tttgccagga
agatggaarc caaaaatgat agggggaatt ggaggtttta tcaaagtaag acagtatgat
cctgtcaacg taattggaag aaatctgttr actcagattg gttgcacttt aaatttt

I don't know whether it's a browser issue, but clicking on # (between the quote bubble and the php, not the key "#") did the above.

Are you sure you want that header in a loop? I'm not sure whether you're redirecting everything from a file or typing it in at the keyboard, but I can't see why you would want that in a loop.

And where do you initialize i? Edit to add: and i really really really needs to be an int, not a char, else you're only going to be able to access (probably) 255 elements of your array.

thanks for the advice, I declared my counter variables as chars. I changed them to int and it works fine. Also I found the hash icon.

My next problem is with my output display. I want to display my array sequence so that only 60 letters are printed per line.

Originally Posted by gkoenig

thanks for the advice, I declared my counter variables as chars. I changed them to int and it works fine. Also I found the hash icon.

My next problem is with my output display. I want to display my array sequence so that only 60 letters are printed per line.

So print it out one character at a time; when you get to sixty, print a \n.

Note that for-loops will handle both the repetitive printing part and the counting to sixty part; or you can use the &#37; (remainder) operator to see whether you just printed a multiple of sixty.

I am having trouble with my loop. I am receiving a "bus error"

here is my source for the loop:

f

Code:

or(x = 0; x<60 ; ++x)
            {
            printf("%s\n", sequence[x]) ;     
                 if(x==60)
                    {
                        printf("\n");
                    }
            }

Sorry for incompetence when it comes to coding, I am a not a programmer.
Any help would be greatly appreciated.

You print a character with %c, not with %s. The for-loop as you have it will only print the first sixty characters, you need to go to strlen(sequence). Something like:

Code:

for (x=0; x < strlen(sequence); ++x)
    {
    printf("%c\n", sequence[x]);
    if (x%60 == 0)
        printf("\n");
    }

again, thanks for the help. you guys and gals are life-savers

I have one last issue with my code. My loop that prints my array out is putting 61 letters on the first line and the correct amount of 60 on the rest. How do I get the first line to print 60 also.

heres the loop:

Code:

for(x = 0; x<strlen(sequence) ; ++x)
            {
            printf("%c", sequence[x]) ;                            
                 if((x%60 == 0) && (x!=0))
                    {
                        printf("\n");
                    }
            }

Do the test before you print the character.

Still having a problem. Heres how I tried to change the code:

Code:

        printf("%c", sequence[0]) ;
        for(x = 1; x<strlen(sequence) ; ++x) // print 60 letters per line.
            {                                        
                 if((x%60 == 0) && (x != 0))
                    {
                        printf("\n") ;
                    }
                 else 
                    {
                    printf("%c", sequence[x]) ;
                    }
            }

I even tried starting a x=0 in the for loop with the same conditional for the if loop