PDA

View Full Version : ...dialup really sucks...



Sebastiani
03-08-2004, 11:18 PM
...for downloading human genomes. :D

If you're curious and patient enough (or have broadband):

c:\>cd genome
c:\genome>ftp genome.cse.ucsc.edu
anonymous
[you@somewhere.com]
binary
cd goldenPath/hg16/bigZips
mget -a

Should be interesting.

nickname_changed
03-09-2004, 03:51 AM
1.3: If I write the code int i, j; can I assume that (&i + 1) == &j?

Wouldn't it be &i + 4 = &j?

Silvercord
03-09-2004, 10:25 AM
im downloading upstream5000.zip on my schools fiber optic but i dont' know what any of these mean! which one should i download?

EDIt:
nevermind its in the readme

EDIT1:


>NM_000367
cggcaaccagctgtaagcgaggcacggaagacatatgcttgtgagacaaa
ggtgtctctgaaactatggatggtacaagaacttcacttgacattgaaga
gtactcggatactgaggtacagaaaaaccaagtactaactctggaagaat


that is what every file looks like.

Lurker
03-09-2004, 04:34 PM
Originally posted by Silvercord

that is what every file looks like.
Duh. That's what it's supposed to look like :D .

vasanth
03-09-2004, 05:10 PM
those are the sequence of the protein if i am right...

Sebastiani
03-09-2004, 05:24 PM
Each letter stands for an amino acid in the DNA chain, (a)denine, (c)ytosine, (g)uanine, or (t)hymine.

Speedy5
03-09-2004, 05:49 PM
If there are only four... They could have put this into binary! 4 letters (a, c, g, t) fit in 2 bits. Then you could fit 4 in a single byte. That would make the size 4 times smaller and 4 times as fast to download! :)

neandrake
03-09-2004, 07:31 PM
Originally posted by stovellp
Wouldn't it be &i + 4 = &j?

I'm assuming you posted this in the wrong place, but no, you are wrong. Well, it might work sometimes, but there's no surefire way of knowing the address of i and j are consectutive, so you might be stepping on other data with &i+4.

Silvercord
03-09-2004, 08:29 PM
Each letter stands for an amino acid in the DNA chain, (a)denine, (c)ytosine, (g)uanine, or (t)hymine.


I really actually honestly thought that. It's neat knowing what those represent, although I personally have no way of knowing if it actually means anything. Im sure it does, but I could produce similar results by typing acgt in seemingly random sequences over and over again :)

It is very cool though thanks for sharing with us.

XSquared
03-09-2004, 08:31 PM
AFAIK, the files are the human genome.

Zach L.
03-09-2004, 08:46 PM
They aren't amino acids, they are nitrogenous bases. The adenine and guanine are pruines, and the cytosine and thymine are pyrimidines.

RoD
03-10-2004, 01:41 AM
cool, loving my cable modem rite now