...dialup really sucks...

This is a discussion on ...dialup really sucks... within the A Brief History of Cprogramming.com forums, part of the Community Boards category; ...for downloading human genomes. If you're curious and patient enough (or have broadband): c:\>cd genome c:\genome>ftp genome.cse.ucsc.edu anonymous [you@somewhere.com] binary ...

  1. #1
    Guest Sebastiani's Avatar
    Join Date
    Aug 2001
    Location
    Waterloo, Texas
    Posts
    5,662

    ...dialup really sucks...

    ...for downloading human genomes.

    If you're curious and patient enough (or have broadband):

    c:\>cd genome
    c:\genome>ftp genome.cse.ucsc.edu
    anonymous
    [you@somewhere.com]
    binary
    cd goldenPath/hg16/bigZips
    mget -a

    Should be interesting.



    ITSA
    Socket Library!

  2. #2
    Banned nickname_changed's Avatar
    Join Date
    Feb 2003
    Location
    Australia
    Posts
    986
    1.3: If I write the code int i, j; can I assume that (&i + 1) == &j?
    Wouldn't it be &i + 4 = &j?

  3. #3
    Banned
    Join Date
    Jan 2003
    Posts
    1,708
    im downloading upstream5000.zip on my schools fiber optic but i dont' know what any of these mean! which one should i download?

    EDIt:
    nevermind its in the readme

    EDIT1:
    >NM_000367
    cggcaaccagctgtaagcgaggcacggaagacatatgcttgtgagacaaa
    ggtgtctctgaaactatggatggtacaagaacttcacttgacattgaaga
    gtactcggatactgaggtacagaaaaaccaagtactaactctggaagaat
    that is what every file looks like.
    Last edited by Silvercord; 03-09-2004 at 09:37 AM.

  4. #4
    The Defective GRAPE Lurker's Avatar
    Join Date
    Feb 2003
    Posts
    949
    Originally posted by Silvercord

    that is what every file looks like.
    Duh. That's what it's supposed to look like .
    Do not make direct eye contact with me.

  5. #5
    Its not rocket science vasanth's Avatar
    Join Date
    Jan 2002
    Posts
    1,683
    those are the sequence of the protein if i am right...

  6. #6
    Guest Sebastiani's Avatar
    Join Date
    Aug 2001
    Location
    Waterloo, Texas
    Posts
    5,662
    Each letter stands for an amino acid in the DNA chain, (a)denine, (c)ytosine, (g)uanine, or (t)hymine.



    ITSA
    Socket Library!

  7. #7
    Registered User
    Join Date
    Jan 2003
    Posts
    648
    If there are only four... They could have put this into binary! 4 letters (a, c, g, t) fit in 2 bits. Then you could fit 4 in a single byte. That would make the size 4 times smaller and 4 times as fast to download!

  8. #8
    30 Helens Agree neandrake's Avatar
    Join Date
    Jan 2002
    Posts
    640
    Originally posted by stovellp
    Wouldn't it be &i + 4 = &j?
    I'm assuming you posted this in the wrong place, but no, you are wrong. Well, it might work sometimes, but there's no surefire way of knowing the address of i and j are consectutive, so you might be stepping on other data with &i+4.
    Environment: OS X, GCC / G++
    Codes: Java, C#, C/C++
    AOL IM: neandrake, Email: neandrake (at) gmail (dot) com

  9. #9
    Banned
    Join Date
    Jan 2003
    Posts
    1,708
    Each letter stands for an amino acid in the DNA chain, (a)denine, (c)ytosine, (g)uanine, or (t)hymine.
    I really actually honestly thought that. It's neat knowing what those represent, although I personally have no way of knowing if it actually means anything. Im sure it does, but I could produce similar results by typing acgt in seemingly random sequences over and over again

    It is very cool though thanks for sharing with us.

  10. #10
    C++ Developer XSquared's Avatar
    Join Date
    Jun 2002
    Location
    Ontario, Canada
    Posts
    2,718
    AFAIK, the files are the human genome.
    Naturally I didn't feel inspired enough to read all the links for you, since I already slaved away for long hours under a blistering sun pressing the search button after typing four whole words! - Quzah

    You. Fetch me my copy of the Wall Street Journal. You two, fight to the death - Stewie

  11. #11
    Toaster Zach L.'s Avatar
    Join Date
    Aug 2001
    Posts
    2,686
    They aren't amino acids, they are nitrogenous bases. The adenine and guanine are pruines, and the cytosine and thymine are pyrimidines.

  12. #12
    RoD
    RoD is offline
    Redundantly Redundant RoD's Avatar
    Join Date
    Sep 2002
    Location
    Missouri
    Posts
    6,331
    cool, loving my cable modem rite now

Popular pages Recent additions subscribe to a feed

Similar Threads

  1. ppp dialup connections
    By rzcodeman in forum Networking/Device Communication
    Replies: 1
    Last Post: 04-15-2004, 01:26 PM
  2. How Cool is Java
    By dukemarlon in forum A Brief History of Cprogramming.com
    Replies: 24
    Last Post: 11-28-2002, 04:24 PM
  3. Why europe sucks
    By compjinx in forum A Brief History of Cprogramming.com
    Replies: 37
    Last Post: 04-08-2002, 07:02 PM
  4. Why the DX8.1 SDK sucks....
    By jdinger in forum A Brief History of Cprogramming.com
    Replies: 12
    Last Post: 04-05-2002, 11:07 PM
  5. Microsoft Sucks
    By mfc2themax in forum A Brief History of Cprogramming.com
    Replies: 110
    Last Post: 11-08-2001, 03:30 PM

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21