...for downloading human genomes.
If you're curious and patient enough (or have broadband):
c:\>cd genome
c:\genome>ftp genome.cse.ucsc.edu
anonymous
[[email protected]]
binary
cd goldenPath/hg16/bigZips
mget -a
Should be interesting.
...for downloading human genomes.
If you're curious and patient enough (or have broadband):
c:\>cd genome
c:\genome>ftp genome.cse.ucsc.edu
anonymous
[[email protected]]
binary
cd goldenPath/hg16/bigZips
mget -a
Should be interesting.
Code:#include <cmath> #include <complex> bool euler_flip(bool value) { return std::pow ( std::complex<float>(std::exp(1.0)), std::complex<float>(0, 1) * std::complex<float>(std::atan(1.0) *(1 << (value + 2))) ).real() < 0; }
Wouldn't it be &i + 4 = &j?1.3: If I write the code int i, j; can I assume that (&i + 1) == &j?
im downloading upstream5000.zip on my schools fiber optic but i dont' know what any of these mean! which one should i download?
EDIt:
nevermind its in the readme
EDIT1:
that is what every file looks like.>NM_000367
cggcaaccagctgtaagcgaggcacggaagacatatgcttgtgagacaaa
ggtgtctctgaaactatggatggtacaagaacttcacttgacattgaaga
gtactcggatactgaggtacagaaaaaccaagtactaactctggaagaat
Last edited by Silvercord; 03-09-2004 at 10:37 AM.
Duh. That's what it's supposed to look like .Originally posted by Silvercord
that is what every file looks like.
Do not make direct eye contact with me.
those are the sequence of the protein if i am right...
Each letter stands for an amino acid in the DNA chain, (a)denine, (c)ytosine, (g)uanine, or (t)hymine.
Code:#include <cmath> #include <complex> bool euler_flip(bool value) { return std::pow ( std::complex<float>(std::exp(1.0)), std::complex<float>(0, 1) * std::complex<float>(std::atan(1.0) *(1 << (value + 2))) ).real() < 0; }
If there are only four... They could have put this into binary! 4 letters (a, c, g, t) fit in 2 bits. Then you could fit 4 in a single byte. That would make the size 4 times smaller and 4 times as fast to download!
I'm assuming you posted this in the wrong place, but no, you are wrong. Well, it might work sometimes, but there's no surefire way of knowing the address of i and j are consectutive, so you might be stepping on other data with &i+4.Originally posted by stovellp
Wouldn't it be &i + 4 = &j?
Environment: OS X, GCC / G++
Codes: Java, C#, C/C++
AOL IM: neandrake, Email: neandrake (at) gmail (dot) com
I really actually honestly thought that. It's neat knowing what those represent, although I personally have no way of knowing if it actually means anything. Im sure it does, but I could produce similar results by typing acgt in seemingly random sequences over and over againEach letter stands for an amino acid in the DNA chain, (a)denine, (c)ytosine, (g)uanine, or (t)hymine.
It is very cool though thanks for sharing with us.
AFAIK, the files are the human genome.
Naturally I didn't feel inspired enough to read all the links for you, since I already slaved away for long hours under a blistering sun pressing the search button after typing four whole words! - Quzah
You. Fetch me my copy of the Wall Street Journal. You two, fight to the death - Stewie
They aren't amino acids, they are nitrogenous bases. The adenine and guanine are pruines, and the cytosine and thymine are pyrimidines.
cool, loving my cable modem rite now